What is crispr-cas9-sim — CRISPR-Cas9 시뮬레이션?

crispr-cas9-sim is a free CRISPR learning tool that toggles SpCas9 (NGG PAM) / xCas9 (NG) / Cas12a (TTTV), extracts sgRNA candidates (20 nt upstream of NGG), scores off-targets using PAM-proximal 12-nt seed weighting, renders blunt-end DSB (3 nt 5' of PAM), and simulates DSB repair branches (NHEJ random indel 1-5 bp 70% / HDR donor 5-38%) — all interactive in-house React + SVG (Doudna & Charpentier 2014 Science / Jinek 2012 / Chen 2017 / eLife 2014 baseline, zero npm).

When should I use crispr-cas9-sim — CRISPR-Cas9 시뮬레이션?

(1) Benchling / CHOPCHOP / CRISPOR are English-only and for production use → undergrad ko/en/ja learning entry (2) NHEJ vs HDR branching is hard to intuit → Monte Carlo distribution + donor slider (3) Learn PAM recognition and 12-nt seed off-target weighting (Doudna 2014 Science) (4) Compare Cas9 variants (xCas9 NG / Cas12a TTTV) (5) Zero external libs — replace Benchling sequence viewer with in-house SVG

Can you show me an example of crispr-cas9-sim — CRISPR-Cas9 시뮬레이션?

Example 1) ACGTACGTACGTACGTACGT_TGG_xxx (NGG PAM) → one sgRNA candidate + DSB at 17 nt Example 2) NHEJ Monte Carlo n=10,000 → indel 1 bp ~35% / 2 bp ~20% / 3 bp ~10% / 4-5 bp ~5% (~70% total ±5%) Example 3) HDR donor slider at 50% → HDR efficiency ≈ 21% (mid 5-38% range) Example 4) 1 mismatch in seed → off-target score ≥0.7 Example 5) 3 mismatches in distal → off-target score ≤0.3 (Cas9 tolerance baseline)

crispr-cas9-sim — CRISPR-Cas9 시뮬레이션Lab

SpCas9 NGG / xCas9 NG / Cas12a TTTV PAM + seed 12 nt + DSB → NHEJ indel 1-5 bp (70%) / HDR donor 5-38% 시나리오 시뮬레이션 (외부 lib 0, ko/en/ja).

DSB site = PAM 5' 3 nt; NHEJ indel 1-5 bp (70%) / HDR donor (5-38%)

TARGET DNA SEQUENCE (≥30 nt)

Cleaned: 99 nt

PAM TYPE

SpCas9 = blunt-end DSB · xCas9 = NG broad PAM · Cas12a = sticky-end DSB

HDR EFFICIENCY (5-38% range, Chen 2017)

Donor concentration0.50

S/G2 phase fraction0.50

Donor = 0 OR S/G2 = 0 → HDR = 0% (G1-only NHEJ). Saturating donor + synchronized S/G2 → max 38%.

Educational simulator

도구 가이드

정의

crispr-cas9-sim은 SpCas9 (NGG PAM) / xCas9 (NG) / Cas12a (TTTV) 3 종 enzyme 토글 + sgRNA 후보 추출 (NGG 상류 20 nt) + seed region (PAM-proximal 12 nt) 가중치 off-target 점수 + blunt-end DSB (PAM 5' 3 nt 상류) + DSB 복구 분기 (NHEJ random indel 1-5 bp 70% / HDR donor 5-38%) 시뮬레이션을 자체 React + SVG로 인터랙티브 박제하는 무료 CRISPR 학습 도구입니다 (Doudna & Charpentier 2014 Science / Jinek 2012 / Chen 2017 / eLife 2014 baseline, 외부 npm 0).

목적

(1) Benchling / CHOPCHOP / CRISPOR — 영문 단독 + 실제 사용 검증용 → 학부 + 한국어/일본어 학습 진입점 (2) NHEJ vs HDR 분기 직관 부재 → Monte Carlo 분포 시각화 + slider donor 농도 (3) PAM 인식 + seed region 가중치 off-target 점수 학습 (Doudna 2014 Science) (4) Cas9 변형 (xCas9 NG / Cas12a TTTV) 비교 학습 (5) 외부 lib 0 — Benchling sequence viewer 자체 SVG 대체

사용법

① Target DNA 서열 입력 (50-500 nt, 5' → 3') ② Enzyme toggle — SpCas9 (NGG) / xCas9 (NG) / Cas12a (TTTV) ③ sgRNA 후보 자동 추출 (PAM 상류 20 nt, 양쪽 strand) + on-target / off-target 점수 (seed 12 nt PAM-proximal 가중치) ④ 후보 클릭 → DSB site SVG (PAM 5' 3 nt 상류 blunt-end), seed region (적색) + distal (회색) 색 구분 ⑤ Donor 제공 toggle + HDR slider (5-38%, Chen 2017) ⑥ Monte Carlo 시뮬레이션 n=10,000 → NHEJ indel 1-5 bp 분포 (1 bp ~35% / 2 bp ~20% / 3 bp ~10% / 4-5 bp ~5%) + frameshift / in-frame / ORF 유지 통계 ⑦ Mismatch 시뮬레이션 — seed 1 mismatch (off-target 高 ≥0.7) vs distal 3 mismatch (off-target 低 ≤0.3) ⑧ 학술 용어 hover (sgRNA / PAM / protospacer / seed / NHEJ / HDR / indel / frameshift / Cas9 / blunt-end 등 16개)

예시

예 1) ACGTACGTACGTACGTACGT_TGG_xxx (NGG PAM) → sgRNA 1 후보 + DSB 17 nt 위치 예 2) NHEJ Monte Carlo n=10,000 → indel 1 bp ~35% / 2 bp ~20% / 3 bp ~10% / 4-5 bp ~5% (총 ~70% ±5%) 예 3) HDR donor slider 50% → HDR 효율 ≈ 21% (5-38% 중간) 예 4) seed region 1 mismatch → off-target 점수 高 ≥0.7 예 5) distal region 3 mismatch → off-target 점수 低 ≤0.3 (Cas9 허용 baseline)